//Written by Paul Stothard, University of Alberta, Canada

function codonUsage (theDocument) {	
	var newDna = "";
	var maxInput = 500000;
	var codonTable;

	if (testScript() == false) {
		return false;
	}

	if ((checkFormElement (theDocument.forms[0].elements[0]) == false) || (checkTextLength(theDocument.forms[0].elements[0].value, maxInput) == false))	{
		return false;
	}

	var geneticCode = getGeneticCodeString(theDocument.forms[0].elements[4].options[theDocument.forms[0].elements[4].selectedIndex].value);	

	geneticCode = geneticCode.split(/,/);

	if (checkGeneticCode(geneticCode) == false)	{
		return false;
	}

	codonTable = makeCodonTable(geneticCode);
	if (codonTable == false) {
		return false;
	}
	resetCounts(codonTable);

	openWindow("Codon Usage");
	openPre();	
	var arrayOfFasta = getArrayOfFasta (theDocument.forms[0].elements[0].value);

	for (var i = 0; i < arrayOfFasta.length; i++)	{
		newDna = getSequenceFromFasta (arrayOfFasta[i]);
		title = getTitleFromFasta (arrayOfFasta[i]);

		newDna = removeNonDna(newDna);

		outputWindow.document.write(getInfoFromTitleAndSequence(title, newDna));

		addCodons(codonTable, newDna);

		codonTable.determineValues();

		writeCodonTable(codonTable);

		resetCounts(codonTable);				

		outputWindow.document.write ('\n\n');
	}


	closePre();
	closeWindow();
	return true;

}




function writeCodonTable(codonTable) {
	outputWindow.document.write (rightNum("AmAcid","",6,"") + rightNum("Codon","",7,"") + rightNum("Number","",10,"") + rightNum("/1000","",12,"") + rightNum("Fraction   ..","",17,"") + "\n\n");
	for (var i = 0; i < codonTable.aminoAcids.length; i++)	{
		arrayOfCodons = codonTable.aminoAcids[i].codons;
		for (var j = 0; j < arrayOfCodons.length; j++)	{
			outputWindow.document.write (rightNum(codonTable.aminoAcids[i].name,"",3,"") + rightNum(arrayOfCodons[j].sequence.toUpperCase(),"",8,"") + rightNum(arrayOfCodons[j].number.toFixed(2),"",12,"") + rightNum(arrayOfCodons[j].perThou.toFixed(2),"",12,"") + rightNum(arrayOfCodons[j].fraction.toFixed(2),"",12,"") + "\n");
		}
		outputWindow.document.write("\n");
	}
}

function addCodons(codonTable, dnaSequence) {
	//replace 'u' with 't'
	dnaSequence = dnaSequence.replace(/u/gi, "t");
	dnaSequence = dnaSequence.replace(/(...)/g, 
                    function (str, p1, offset, s) {
                      	return " " + p1 + " ";
                   }
        );
	
	var matchExp;
	var arrayOfCodons;
	for (var i = 0; i < codonTable.aminoAcids.length; i++)	{
		arrayOfCodons = codonTable.aminoAcids[i].codons;
		for (var j = 0; j < arrayOfCodons.length; j++)	{
			matchExp = new RegExp(arrayOfCodons[j].sequence, "gi");
			if (dnaSequence.search(matchExp) != -1)	{
				arrayOfCodons[j].number	= arrayOfCodons[j].number + ((dnaSequence.match(matchExp)).length);
			}
		}		
		
	}
}

function resetCounts(codonTable) {
	for (var i = 0; i < codonTable.aminoAcids.length; i++)	{
		arrayOfCodons = codonTable.aminoAcids[i].codons;
		for (var j = 0; j < arrayOfCodons.length; j++)	{
			arrayOfCodons[j].resetValues();
		}		
		
	}
}
		

function makeCodonTable(geneticCode) {

	var codonSequence = "gggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc";

	var proteinSequence;
	var codonTable = new CodonTable();

	var geneticCodeMatchExp = getGeneticCodeMatchExp (geneticCode);
	var geneticCodeMatchResult = getGeneticCodeMatchResult (geneticCode);

	codonSequence = codonSequence.replace(/(...)/g, 
                    function (str, p1, offset, s) {
                      	return " " + p1 + " ";
                   }
        );

	var codonSequenceCopy = codonSequence;

	for (var i = 0; i < geneticCodeMatchExp.length; i++)	{
		codonSequence = codonSequence.replace(geneticCodeMatchExp[i], geneticCodeMatchResult[i]);
	}
	var codonArray = codonSequenceCopy.split(/\s+/);

	codonSequence = codonSequence.replace(/\*/g, "Z");
	var proteinArray = codonSequence.split(/\s+/);

	for (var i = 0; i < codonArray.length; i++)	{
		//on some systems there will be empty items because of split function
		if ((proteinArray[i] == "") && (codonArray[i] == "")) {
			continue;
		}
		codonTable[proteinArray[i].toLowerCase()].addCodon(new Codon(codonArray[i], 0, 0, 0));
	}
	return codonTable;	
}


//class CodonTable method determineValues()
function determineValues() {
	var totalAminoAcids = 0;
	var aminoAcid = 0;
	var arrayOfCodons;
	for (var i = 0; i < this.aminoAcids.length; i++)	{
		arrayOfCodons = this.aminoAcids[i].codons;
		for (var j = 0; j < arrayOfCodons.length; j++)	{
			totalAminoAcids = totalAminoAcids + arrayOfCodons[j].number;
			aminoAcid = aminoAcid + arrayOfCodons[j].number;
		}
		this.aminoAcids[i].count = aminoAcid;		
		aminoAcid = 0;
	}

	for (var i = 0; i < this.aminoAcids.length; i++)	{
		arrayOfCodons = this.aminoAcids[i].codons;
		for (var j = 0; j < arrayOfCodons.length; j++)	{			
			if (arrayOfCodons[j].number > 0) {
				arrayOfCodons[j].fraction = arrayOfCodons[j].number / this.aminoAcids[i].count;
				arrayOfCodons[j].perThou = 1000*(arrayOfCodons[j].number / totalAminoAcids);	
			}
			else {
				arrayOfCodons[j].fraction = 0;
				arrayOfCodons[j].perThou = 0;
			}
		}
	}
}

//class CodonTable
function CodonTable() {
	this.a = new AminoAcid("Ala");
	this.c = new AminoAcid("Cys");
	this.d = new AminoAcid("Asp");
	this.e = new AminoAcid("Glu");
	this.f = new AminoAcid("Phe");
	this.g = new AminoAcid("Gly");
	this.h = new AminoAcid("His");
	this.i = new AminoAcid("Ile");
	this.k = new AminoAcid("Lys");
	this.l = new AminoAcid("Leu");
	this.m = new AminoAcid("Met");
	this.n = new AminoAcid("Asn");
	this.p = new AminoAcid("Pro");
	this.q = new AminoAcid("Gln");
	this.r = new AminoAcid("Arg");
	this.s = new AminoAcid("Ser");
	this.t = new AminoAcid("Thr");
	this.v = new AminoAcid("Val");
	this.w = new AminoAcid("Trp");
	this.y = new AminoAcid("Tyr");
	this.z = new AminoAcid("End");

	this.ala = this.a;
	this.cys = this.c;
	this.asp = this.d;
	this.glu = this.e;
	this.phe = this.f;
	this.gly = this.g;
	this.his = this.h;
	this.ile = this.i;
	this.lys = this.k;
	this.leu = this.l;
	this.met = this.m;
	this.asn = this.n;
	this.pro = this.p;
	this.gln = this.q;
	this.arg = this.r;
	this.ser = this.s;
	this.thr = this.t;
	this.val = this.v;
	this.trp = this.w;
	this.tyr = this.y;
	this.end = this.z;

	this.aminoAcids = new Array(this.a, this.c, this.d, this.e, this.f, this.g, this.h, this.i, this.k, this.l, this.m, this.n, this.p, this.q, this.r, this.s, this.t, this.v, this.w, this.y, this.z);
}

//create and throw away a prototype object
new CodonTable();

//define object methods	
CodonTable.prototype.determineValues = determineValues;


//class AminoAcid method count()
function count() {
	for (var i = 0; i < this.codons.length; i++)	{
		this.number = this.number + this.codons[i];
	}
}

//class AminoAcid method addCodon()
function addCodon(codon) {
	this.codons.push(codon);	
}

//class AminoAcid
function AminoAcid(name) {
	this.name = name;
	this.codons = new Array();
	this.number = 0;
}

//create and throw away a prototype object
new AminoAcid("");

//define object methods	
AminoAcid.prototype.addCodon = addCodon;
AminoAcid.prototype.count = count;


//class Codon method resetValues()
function resetValues() {
	this.number = 0;
	this.perThou = 0;
	this.fraction = 0;
}

//class Codon
function Codon(sequence, number, perThou, fraction) {
	this.sequence = sequence.toLowerCase();
	this.number = number;
	this.perThou = perThou;
	this.fraction = fraction;
}

//create and throw away a prototype object
new Codon("", 0, 0, 0);

//define object methods	
Codon.prototype.resetValues = resetValues;